Our DNA is made up of lots of individual building blocks represented by the letters A,C,T and G. The DMPK gene contains lots of Cs,Ts and Gs repeated over and over like this:
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG…
The CTG ‘triplet’ in the DMPK gene is usually repeated between five and 34 times in a healthy person. However, in someone with myotonic dystrophy type 1 (including the congenital form), the CTG triplet is unstable and is repeated more than this.
The number of CTG repeats in the DMPK gene generally correlates with the severity of the condition and the age of onset. For example, individuals with 50 to 100 repeats are usually mildly affected and symptoms may not arise until adulthood. In contrast, individuals with thousands of repeats are likely to have the severe, congenital form described in this factsheet.
The number of CTG repeats, and hence the severity of the condition, usually increases from generation to generation. This is why it is possible for a mildly-affected parent to have a child with congenital myotonic dystrophy.
Recent scientific advances have shown that too many CTG repeats leads to abnormal RNA production in the cells of people with myotonic dystrophy type 1. When a gene is expressed (or active), RNA copies of the gene are produced in the cell nucleus. This RNA acts as a messenger that travels out of the nucleus and then instructs the cell’s machinery to make proteins.
In myotonic dystrophy type 1, this RNA production process is disrupted. Too many CTG repeats in the DMPK gene cause the resulting RNA to have an unusual shape. It becomes trapped in clumps in the nucleus and affects the function of important proteins that regulate other genes. It is the disruption of these other genes that is thought to cause the body-wide symptoms of myotonic dystrophy type 1.
What happens inside cells affected by myotonic dystrophy
How is congenital myotonic dystrophy inherited?
In 99 percent of families, congenital myotonic dystrophy is inherited from an affected mother. In one percent of cases, the father is the affected parent. Myotonic dystrophy follows a ‘dominant’ inheritance pattern. This means that people with the condition (including the congenital form) have a 50:50 chance of passing it on to their children.
Once a mother has had one child affected with congenital myotonic dystrophy, any of her other children are also very likely to have the same condition. Children who do not inherit the genetic change that causes it will not be affected by myotonic dystrophy and cannot pass it on to their children either. Congenital myotonic dystrophy can affect both sexes, with the mother almost always being the affected parent.